p-value: | 1e-15 |
log p-value: | -3.530e+01 |
Information Content per bp: | 1.694 |
Number of Target Sequences with motif | 547.0 |
Percentage of Target Sequences with motif | 36.37% |
Number of Background Sequences with motif | 12521.5 |
Percentage of Background Sequences with motif | 26.87% |
Average Position of motif in Targets | 101.4 +/- 50.0bp |
Average Position of motif in Background | 100.3 +/- 64.0bp |
Strand Bias (log2 ratio + to - strand density) | -0.1 |
Multiplicity (# of sites on avg that occur together) | 1.25 |
Motif File: | file (matrix) reverse opposite |
SVG Files for Logos: | forward logo reverse opposite |
CG2950(KH)/Drosophila_melanogaster-RNCMPT00007-PBM/HughesRNA
Match Rank: | 1 |
Score: | 0.79 |
Offset: | -1 |
Orientation: | reverse strand |
Alignment: | -TCRTVG NTCGTTG |
|
|
|
RSF1(RRM)/Drosophila_melanogaster-RNCMPT00061-PBM/HughesRNA
Match Rank: | 2 |
Score: | 0.73 |
Offset: | 0 |
Orientation: | reverse strand |
Alignment: | TCRTVG- TCGTCGT |
|
|
|
Rbm4.3(RRM)/Danio_rerio-RNCMPT00248-PBM/HughesRNA
Match Rank: | 3 |
Score: | 0.71 |
Offset: | 0 |
Orientation: | reverse strand |
Alignment: | TCRTVG-- TCGTCGTN |
|
|
|
DOT6/MA0351.1/Jaspar
Match Rank: | 4 |
Score: | 0.69 |
Offset: | -9 |
Orientation: | forward strand |
Alignment: | ---------TCRTVG------ TTCTGCACCTCATCGCATCCT |
|
|
|
TOD6/MA0350.1/Jaspar
Match Rank: | 5 |
Score: | 0.69 |
Offset: | -9 |
Orientation: | forward strand |
Alignment: | ---------TCRTVG------ AGGCACAGCTCATCGCGTTTT |
|
|
|
CHA4(MacIsaac)/Yeast
Match Rank: | 6 |
Score: | 0.67 |
Offset: | -1 |
Orientation: | reverse strand |
Alignment: | -TCRTVG-- CTCATCGCA |
|
|
|
RBP1-LIKE(RRM)/Drosophila_melanogaster-RNCMPT00127-PBM/HughesRNA
Match Rank: | 7 |
Score: | 0.66 |
Offset: | -1 |
Orientation: | forward strand |
Alignment: | -TCRTVG ATCAACG |
|
|
|
schlank/MA0193.1/Jaspar
Match Rank: | 8 |
Score: | 0.65 |
Offset: | -1 |
Orientation: | reverse strand |
Alignment: | -TCRTVG TTGGTAG |
|
|
|
SOX18/MA1563.1/Jaspar
Match Rank: | 9 |
Score: | 0.64 |
Offset: | 0 |
Orientation: | reverse strand |
Alignment: | TCRTVG-- GCATTGTN |
|
|
|
TCF7/MA0769.2/Jaspar
Match Rank: | 10 |
Score: | 0.63 |
Offset: | -3 |
Orientation: | reverse strand |
Alignment: | ---TCRTVG-- ANATCAAAGNN |
|
|
|