p-value: | 1e-12 |
log p-value: | -2.832e+01 |
Information Content per bp: | 1.735 |
Number of Target Sequences with motif | 484.0 |
Percentage of Target Sequences with motif | 57.28% |
Number of Background Sequences with motif | 21427.2 |
Percentage of Background Sequences with motif | 44.98% |
Average Position of motif in Targets | 104.1 +/- 50.5bp |
Average Position of motif in Background | 99.9 +/- 65.8bp |
Strand Bias (log2 ratio + to - strand density) | 0.1 |
Multiplicity (# of sites on avg that occur together) | 1.39 |
Motif File: | file (matrix) reverse opposite |
SVG Files for Logos: | forward logo reverse opposite |
RBP1-LIKE(RRM)/Drosophila_melanogaster-RNCMPT00127-PBM/HughesRNA
Match Rank: | 1 |
Score: | 0.77 |
Offset: | -2 |
Orientation: | forward strand |
Alignment: | --CATCGT ATCAACG- |
|
|
|
AGL42/MA1201.1/Jaspar
Match Rank: | 2 |
Score: | 0.76 |
Offset: | 0 |
Orientation: | forward strand |
Alignment: | CATCGT- CATCATC |
|
|
|
Tb_0216(RRM)/Trypanosoma_brucei-RNCMPT00216-PBM/HughesRNA
Match Rank: | 3 |
Score: | 0.74 |
Offset: | 0 |
Orientation: | forward strand |
Alignment: | CATCGT- CATTGTN |
|
|
|
RSF1(RRM)/Drosophila_melanogaster-RNCMPT00061-PBM/HughesRNA
Match Rank: | 4 |
Score: | 0.73 |
Offset: | -1 |
Orientation: | reverse strand |
Alignment: | -CATCGT TCGTCGT |
|
|
|
DOT6/MA0351.1/Jaspar
Match Rank: | 5 |
Score: | 0.72 |
Offset: | -10 |
Orientation: | forward strand |
Alignment: | ----------CATCGT----- TTCTGCACCTCATCGCATCCT |
|
|
|
RBM47(RRM)/Gallus_gallus-RNCMPT00279-PBM/HughesRNA
Match Rank: | 6 |
Score: | 0.72 |
Offset: | -3 |
Orientation: | reverse strand |
Alignment: | ---CATCGT NATCATC-- |
|
|
|
YBX1(CSD)/Homo_sapiens-RNCMPT00116-PBM/HughesRNA
Match Rank: | 7 |
Score: | 0.72 |
Offset: | -2 |
Orientation: | forward strand |
Alignment: | --CATCGT AACATCA- |
|
|
|
Rbm4.3(RRM)/Danio_rerio-RNCMPT00248-PBM/HughesRNA
Match Rank: | 8 |
Score: | 0.71 |
Offset: | -1 |
Orientation: | reverse strand |
Alignment: | -CATCGT- TCGTCGTN |
|
|
|
G3BP2(RRM)/Homo_sapiens-RNCMPT00021-PBM/HughesRNA
Match Rank: | 9 |
Score: | 0.71 |
Offset: | -1 |
Orientation: | reverse strand |
Alignment: | -CATCGT TCATCCT |
|
|
|
TOD6/MA0350.1/Jaspar
Match Rank: | 10 |
Score: | 0.71 |
Offset: | -10 |
Orientation: | forward strand |
Alignment: | ----------CATCGT----- AGGCACAGCTCATCGCGTTTT |
|
|
|